Journal: EBioMedicine

Article Title: Quantitative contribution of efflux to multi-drug resistance of clinical Escherichia coli and Pseudomonas aeruginosa strains

doi: 10.1016/j.ebiom.2019.02.061

Figure Lengend Snippet: Genome diversity of clinical Escherichia coli strains and geme deletion plasmid. ( a , b ) Analysis of clinical MDR Escherichia coli strains by whole genome sequencing. ( b ) Tree illustrating the relationship between 18 strains for which we could obtain Δ tolC mutants, based on the cgMLST (core genome multi-locus sequence typing) allelic profiles. The scale bar represents 200 allelic differences. The tree is colored according to MLST sequence types (STs). Strains EC19 to EC24, for which were unable to obtain Δ tolC mutants are marked with asterisks. ( c ) Occurrence of acquired antimicrobial resistance genes as detected by ResFinder and chromosomal point mutations (ChrPM) associated with antimicrobial resistance as identified by PointFinder . ( c ) Plasmid for deleting genes in MDR bacterial pathogens. The plasmid carries the R6K γ origin of replication which depends on the replication protein π (encoded by pir ) which is absent in almost all clinical strains; tpm encoding thiopurine- S -methyltranferase, which confers resistance to tellurite (most MDR clinical isolates are sensitive to tellurite); the origin of conjugational transfer oriT ; traJ encoding the transcriptional activator for conjugational transfer genes; sacB encoding levansucrase, which confers sensitivity to sucrose. The hatched regions fl-up and fl-do represent flanking regions of the target gene for deletion. The hooked arrows represent promoters.

Article Snippet: Reads were mapped to the reference Escherichia coli ATCC 25922 genome (GenBank: CP009072.1 (ATCC 25922) and 1855 genes belonging to the common core genome were analyzed for their allelic differences (core genome Multilocus Sequence Typing, cgMLST [ , ]).

Techniques: Plasmid Preparation, Sequencing

Journal: EBioMedicine

Article Title: Quantitative contribution of efflux to multi-drug resistance of clinical Escherichia coli and Pseudomonas aeruginosa strains

doi: 10.1016/j.ebiom.2019.02.061

Figure Lengend Snippet: Impact of genetic inactivation of efflux on antimicrobial susceptibility in MDR E.coli . ( a , b ) Efflux activities in clinical isolates and corresponding Δ tolC mutants. ( a ) Energy-depleted cells were loaded with Nile red. Cells were then re-energized with glucose (arrow, 120 s), and efflux was measured as decrease in Nile red fluorescence (which is lower in aqueous solution compared to bacterial membranes). All isolates except EC18 showed rapid energy-dependent efflux (representative example shown in black), whereas all Δ tolC mutants showed no, or much slower, fluorescence loss upon energization (examples shown as dashed black or magenta lines). EC18 (blue dotted line) and its Δ tolC mutant (orange dotted line) lost fluorescence in an energy-independent manner (i.e., even prior to glucose addition) preventing quantitative analysis of efflux. Representative traces for the laboratory strain K-12 and its Δ tolC mutant are shown for comparison (grey lines). ( b ) Time intervals after energization until 50% of fluorescence intensity was lost. Time resolution prevented measurement of half-times below 10 s (dotted line) or above 300 s (dashed line). ( c , d ) Minimal inhibitory concentrations that prevent growth (MICs) of Escherichia coli isolates and corresponding Δ tolC mutants. Data are shown for drugs that are normally ineffective against Escherichia coli ( c ), and for common therapeutically used antimicrobials ( d ). Crosses represent values for parental isolates. The impact of Δ tolC deletion is represented by arrows. If there is no arrow, the mutant MIC remained at the parental level. MIC ranges corresponding to clinical resistance (red) or susceptibility (blue) according to EUCAST breakpoints are shown as background. Breakpoints shown in (c) are estimates based on values for other bacterial pathogens. MIC values outside the measurement range are shown as shaded areas. The thick blue arrows mark conversion of clinical resistance to susceptibility as a result of genetic inactivation of major efflux systems, while the dotted blue line for EC08 and amikacin should still be reported as “intermediate” (see text). K-12 had MIC values below the lowest measured concentration (shaded blue regions) for all antibiotics shown in (d). ( e,f ) Impact of additional inactivation of specific resistance determinants in efflux-deficient strains. ( e ) Comparison of susceptibility of parental strains, their Δ tolC mutants, and various double mutants (AMC, Amoxicillin/Clavulanic acid; SXT, Trimethoprim-sulfamethoxazole). We determined susceptibility to ciprofloxacin using a broth microdilution technique to cover the nanomolar concentration range. ( f ) Antimicrobial spectrum changes in double mutants (blue, switch from “resistant” or “intermediate” in the tolC mutant to “susceptible” in the double mutant; white, “susceptible” unaltered; red, “resistant” unaltered; CAZ, Ceftazidime; CIP, Ciprofloxacin; CRO, Ceftriaxone; DOX, Doxycycline; FEP, Cefepime; TOB, Tobramycin; TZP, Piperacillin/Tazobactam). The blue crosses indicate resistance mechanisms that were specifically inactivated in each of the four double mutants. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

Article Snippet: Reads were mapped to the reference Escherichia coli ATCC 25922 genome (GenBank: CP009072.1 (ATCC 25922) and 1855 genes belonging to the common core genome were analyzed for their allelic differences (core genome Multilocus Sequence Typing, cgMLST [ , ]).

Techniques: Fluorescence, Mutagenesis, Comparison, Concentration Assay

Journal: Investigative Ophthalmology & Visual Science

Article Title: Normalization of Wound Healing and Diabetic Markers in Organ Cultured Human Diabetic Corneas by Adenoviral Delivery of c-Met Gene

doi: 10.1167/iovs.09-4569

Figure Lengend Snippet: Antibodies

Article Snippet: The following gene-specific assay kits were used as per ABI: c-met proto-oncogene assay ID Hs00179845_m1 (GenBank RefSeq {"type":"entrez-nucleotide","attrs":{"text":"NM_001127500.1","term_id":"188595715","term_text":"NM_001127500.1"}} NM_001127500.1 , exon boundary 10-11; assay location, 2605; amplicon size, 81 bp) and β 2 -microglobulin assay ID Hs99999907_m1 (GenBank RefSeq {"type":"entrez-nucleotide","attrs":{"text":"NM_004048.2","term_id":"37704380","term_text":"NM_004048.2"}} NM_004048.2 , exon boundary 2-3; assay location, 413; amplicon size, 75 bp) ( www.ncbi.nlm.nih.gov/locuslink/refseq/ RefSeq is provided in the public domain by the National Center for Biotechnology Information, Bethesda, MD).

Techniques: Western Blot, Transduction, Immunohistochemistry

Journal: Investigative Ophthalmology & Visual Science

Article Title: Normalization of Wound Healing and Diabetic Markers in Organ Cultured Human Diabetic Corneas by Adenoviral Delivery of c-Met Gene

doi: 10.1167/iovs.09-4569

Figure Lengend Snippet: rAV-cmet transduction into organ cultured human diabetic corneas and U87MG cells led to c-met overexpression. (A) Immunoblot analysis of total protein from corneas transduced with rAV-cmet and rAV-vector probed with rabbit pAb sc-161 (left), and from U87MG cell lysates (right). Arrows: 170-kDa full-length c-met, 140- to 145–kDa processed chain, and 55- to 60-kDa cell-associated fragment. Note that, in glioma cells, transduced c-met gets processed and mainly a 145-kDa chain is detected, whereas in the corneas, a full-length protein is present together with a prominent smaller band, apparently corresponding to a cell-associated kinase fragment. β-Actin was used to normalize protein loading. M, markers in kilodaltons. (B) Quantitative RT-PCR. On c-met gene transduction, its mRNA level increased approximately threefold in the epithelium, but stromal level did not change. Ratios to vector control are presented. β2-microglobulin was used as the housekeeping gene.

Article Snippet: The following gene-specific assay kits were used as per ABI: c-met proto-oncogene assay ID Hs00179845_m1 (GenBank RefSeq {"type":"entrez-nucleotide","attrs":{"text":"NM_001127500.1","term_id":"188595715","term_text":"NM_001127500.1"}} NM_001127500.1 , exon boundary 10-11; assay location, 2605; amplicon size, 81 bp) and β 2 -microglobulin assay ID Hs99999907_m1 (GenBank RefSeq {"type":"entrez-nucleotide","attrs":{"text":"NM_004048.2","term_id":"37704380","term_text":"NM_004048.2"}} NM_004048.2 , exon boundary 2-3; assay location, 413; amplicon size, 75 bp) ( www.ncbi.nlm.nih.gov/locuslink/refseq/ RefSeq is provided in the public domain by the National Center for Biotechnology Information, Bethesda, MD).

Techniques: Transduction, Cell Culture, Over Expression, Western Blot, Plasmid Preparation, Quantitative RT-PCR

Journal: Investigative Ophthalmology & Visual Science

Article Title: Normalization of Wound Healing and Diabetic Markers in Organ Cultured Human Diabetic Corneas by Adenoviral Delivery of c-Met Gene

doi: 10.1167/iovs.09-4569

Figure Lengend Snippet: Transduction of c-met to organ cultured human diabetic corneas caused its increased expression and phosphorylation. Left: rAV-vector transduction; right: rAV-cmet transduction. In corneas transduced with rAV-cmet, there was increased epithelial staining for total c-met (revealed with a C-terminal rabbit pAb sc-10), tyrosine-phosphorylated (PY) c-met, and extracellular (EX) c-met. Indirect immunofluorescence of corneal sections. Sections of wounded and healed corneas are shown; the same exposure time was used for each pair of fellow corneas. e, epithelium; s, stroma.

Article Snippet: The following gene-specific assay kits were used as per ABI: c-met proto-oncogene assay ID Hs00179845_m1 (GenBank RefSeq {"type":"entrez-nucleotide","attrs":{"text":"NM_001127500.1","term_id":"188595715","term_text":"NM_001127500.1"}} NM_001127500.1 , exon boundary 10-11; assay location, 2605; amplicon size, 81 bp) and β 2 -microglobulin assay ID Hs99999907_m1 (GenBank RefSeq {"type":"entrez-nucleotide","attrs":{"text":"NM_004048.2","term_id":"37704380","term_text":"NM_004048.2"}} NM_004048.2 , exon boundary 2-3; assay location, 413; amplicon size, 75 bp) ( www.ncbi.nlm.nih.gov/locuslink/refseq/ RefSeq is provided in the public domain by the National Center for Biotechnology Information, Bethesda, MD).

Techniques: Transduction, Cell Culture, Expressing, Plasmid Preparation, Staining, Immunofluorescence

Journal: Investigative Ophthalmology & Visual Science

Article Title: Normalization of Wound Healing and Diabetic Markers in Organ Cultured Human Diabetic Corneas by Adenoviral Delivery of c-Met Gene

doi: 10.1167/iovs.09-4569

Figure Lengend Snippet: c-Met transduction to organ cultured human diabetic corneas normalized expression patterns of select diabetic markers. Staining for integrin α3β1 became more homogeneous, and its intensity increased (top row). Staining for the BM component laminin-γ1 chain appeared after c-met transduction (second row). Staining for BM nidogen-1 and -2 (double labeling is shown in the two bottom rows) remained interrupted on vector transduction but became homogeneous after c-met transduction, similar to normal corneas. Indirect immunofluorescence of corneal sections. e, epithelium; s, stroma.

Article Snippet: The following gene-specific assay kits were used as per ABI: c-met proto-oncogene assay ID Hs00179845_m1 (GenBank RefSeq {"type":"entrez-nucleotide","attrs":{"text":"NM_001127500.1","term_id":"188595715","term_text":"NM_001127500.1"}} NM_001127500.1 , exon boundary 10-11; assay location, 2605; amplicon size, 81 bp) and β 2 -microglobulin assay ID Hs99999907_m1 (GenBank RefSeq {"type":"entrez-nucleotide","attrs":{"text":"NM_004048.2","term_id":"37704380","term_text":"NM_004048.2"}} NM_004048.2 , exon boundary 2-3; assay location, 413; amplicon size, 75 bp) ( www.ncbi.nlm.nih.gov/locuslink/refseq/ RefSeq is provided in the public domain by the National Center for Biotechnology Information, Bethesda, MD).

Techniques: Transduction, Cell Culture, Expressing, Staining, Labeling, Plasmid Preparation, Immunofluorescence

Journal: Investigative Ophthalmology & Visual Science

Article Title: Normalization of Wound Healing and Diabetic Markers in Organ Cultured Human Diabetic Corneas by Adenoviral Delivery of c-Met Gene

doi: 10.1167/iovs.09-4569

Figure Lengend Snippet: c-Met transduction did not change tight junction protein patterns. Top row: immunostaining for claudin-1 with typical membrane staining of all cell layers; bottom row: staining for ZO-1 mostly expressed in upper epithelial layers. None of these tight junction proteins appeared to change after c-met transduction. Indirect immunofluorescence of corneal sections. e, epithelium; s, stroma.

Article Snippet: The following gene-specific assay kits were used as per ABI: c-met proto-oncogene assay ID Hs00179845_m1 (GenBank RefSeq {"type":"entrez-nucleotide","attrs":{"text":"NM_001127500.1","term_id":"188595715","term_text":"NM_001127500.1"}} NM_001127500.1 , exon boundary 10-11; assay location, 2605; amplicon size, 81 bp) and β 2 -microglobulin assay ID Hs99999907_m1 (GenBank RefSeq {"type":"entrez-nucleotide","attrs":{"text":"NM_004048.2","term_id":"37704380","term_text":"NM_004048.2"}} NM_004048.2 , exon boundary 2-3; assay location, 413; amplicon size, 75 bp) ( www.ncbi.nlm.nih.gov/locuslink/refseq/ RefSeq is provided in the public domain by the National Center for Biotechnology Information, Bethesda, MD).

Techniques: Transduction, Immunostaining, Staining, Immunofluorescence

Journal: Investigative Ophthalmology & Visual Science

Article Title: Normalization of Wound Healing and Diabetic Markers in Organ Cultured Human Diabetic Corneas by Adenoviral Delivery of c-Met Gene

doi: 10.1167/iovs.09-4569

Figure Lengend Snippet: Dynamics of wound healing. A typical course of healing is presented for a c-met–transduced and vector-transduced cornea. rAV-vector–transduced diabetic cornea (top row) healed in 7 days, whereas rAV-met–transduced fellow cornea (bottom row) healed in 3 days. Pictures of live healing corneas are shown. Dashed line: shows the boundaries of the nonhealed wound region. W, wound zone; E, migrating epithelium.

Article Snippet: The following gene-specific assay kits were used as per ABI: c-met proto-oncogene assay ID Hs00179845_m1 (GenBank RefSeq {"type":"entrez-nucleotide","attrs":{"text":"NM_001127500.1","term_id":"188595715","term_text":"NM_001127500.1"}} NM_001127500.1 , exon boundary 10-11; assay location, 2605; amplicon size, 81 bp) and β 2 -microglobulin assay ID Hs99999907_m1 (GenBank RefSeq {"type":"entrez-nucleotide","attrs":{"text":"NM_004048.2","term_id":"37704380","term_text":"NM_004048.2"}} NM_004048.2 , exon boundary 2-3; assay location, 413; amplicon size, 75 bp) ( www.ncbi.nlm.nih.gov/locuslink/refseq/ RefSeq is provided in the public domain by the National Center for Biotechnology Information, Bethesda, MD).

Techniques: Plasmid Preparation

Journal: Investigative Ophthalmology & Visual Science

Article Title: Normalization of Wound Healing and Diabetic Markers in Organ Cultured Human Diabetic Corneas by Adenoviral Delivery of c-Met Gene

doi: 10.1167/iovs.09-4569

Figure Lengend Snippet: c-Met overexpression led to a significant decrease in corneal epithelial wound healing time. The average healing time of rAV-vector–transduced corneas was 6.1 days, whereas rAV-cmet–transduced corneas healed in 3.1 days on average. For comparison, previous data on normal corneas11 are also shown. They healed in 2.3 days on average. Note that vector-treated diabetic corneas healed significantly slower than normal. c-Met transduction led to a significant decrease in healing time, bringing it close to normal. Statistical analysis of the time to complete healing (n = 7 for vector and c-met, and n = 13 for normal). Significance was determined using ANOVA with the Bonferroni post test.

Article Snippet: The following gene-specific assay kits were used as per ABI: c-met proto-oncogene assay ID Hs00179845_m1 (GenBank RefSeq {"type":"entrez-nucleotide","attrs":{"text":"NM_001127500.1","term_id":"188595715","term_text":"NM_001127500.1"}} NM_001127500.1 , exon boundary 10-11; assay location, 2605; amplicon size, 81 bp) and β 2 -microglobulin assay ID Hs99999907_m1 (GenBank RefSeq {"type":"entrez-nucleotide","attrs":{"text":"NM_004048.2","term_id":"37704380","term_text":"NM_004048.2"}} NM_004048.2 , exon boundary 2-3; assay location, 413; amplicon size, 75 bp) ( www.ncbi.nlm.nih.gov/locuslink/refseq/ RefSeq is provided in the public domain by the National Center for Biotechnology Information, Bethesda, MD).

Techniques: Over Expression, Plasmid Preparation, Transduction

Journal: Investigative Ophthalmology & Visual Science

Article Title: Normalization of Wound Healing and Diabetic Markers in Organ Cultured Human Diabetic Corneas by Adenoviral Delivery of c-Met Gene

doi: 10.1167/iovs.09-4569

Figure Lengend Snippet: c-Met overexpression leads to increased phosphorylation of p38 MAP kinase. Top row: increased epithelial staining for the phosphorylated form of p38 (p-p38). Staining for phosphorylated forms of Akt (p-Akt, middle row) or ERK (p-ERK, bottom row) kinases did not show noticeable change on c-met transduction. Indirect immunofluorescence of corneal sections. e, epithelium; s, stroma.

Article Snippet: The following gene-specific assay kits were used as per ABI: c-met proto-oncogene assay ID Hs00179845_m1 (GenBank RefSeq {"type":"entrez-nucleotide","attrs":{"text":"NM_001127500.1","term_id":"188595715","term_text":"NM_001127500.1"}} NM_001127500.1 , exon boundary 10-11; assay location, 2605; amplicon size, 81 bp) and β 2 -microglobulin assay ID Hs99999907_m1 (GenBank RefSeq {"type":"entrez-nucleotide","attrs":{"text":"NM_004048.2","term_id":"37704380","term_text":"NM_004048.2"}} NM_004048.2 , exon boundary 2-3; assay location, 413; amplicon size, 75 bp) ( www.ncbi.nlm.nih.gov/locuslink/refseq/ RefSeq is provided in the public domain by the National Center for Biotechnology Information, Bethesda, MD).

Techniques: Over Expression, Staining, Transduction, Immunofluorescence

Journal: Investigative Ophthalmology & Visual Science

Article Title: Normalization of Wound Healing and Diabetic Markers in Organ Cultured Human Diabetic Corneas by Adenoviral Delivery of c-Met Gene

doi: 10.1167/iovs.09-4569

Figure Lengend Snippet: Phosphoproteomic array analysis of MAPKs. (A) On c-met transduction, phosphorylated p38α (p-p38α) was significantly (2.1-fold, n = 6, P < 0.05) increased compared with vector transduction. Array membranes were probed with total corneal protein, and signal was detected with chemiluminescence. (B) Validation of array results by Western blot analysis. Two separate cases are shown; in both of them p-p38 was increased on c-met transduction compared with vector alone. Mean increase in c-met versus vector was 1.7 ± 0.2 (n = 5, P < 0.04). Gel loading was normalized by β-actin. M, markers in kilodaltons.

Article Snippet: The following gene-specific assay kits were used as per ABI: c-met proto-oncogene assay ID Hs00179845_m1 (GenBank RefSeq {"type":"entrez-nucleotide","attrs":{"text":"NM_001127500.1","term_id":"188595715","term_text":"NM_001127500.1"}} NM_001127500.1 , exon boundary 10-11; assay location, 2605; amplicon size, 81 bp) and β 2 -microglobulin assay ID Hs99999907_m1 (GenBank RefSeq {"type":"entrez-nucleotide","attrs":{"text":"NM_004048.2","term_id":"37704380","term_text":"NM_004048.2"}} NM_004048.2 , exon boundary 2-3; assay location, 413; amplicon size, 75 bp) ( www.ncbi.nlm.nih.gov/locuslink/refseq/ RefSeq is provided in the public domain by the National Center for Biotechnology Information, Bethesda, MD).

Techniques: Transduction, Plasmid Preparation, Western Blot

Journal: Investigative Ophthalmology & Visual Science

Article Title: Normalization of Wound Healing and Diabetic Markers in Organ Cultured Human Diabetic Corneas by Adenoviral Delivery of c-Met Gene

doi: 10.1167/iovs.09-4569

Figure Lengend Snippet: Dynamics of wound healing on treatment with p38 inhibitor. (A, top row) rAV-vector–transduced diabetic cornea completely healed in 4 days in the presence of 10 μM of the inactive p38 inhibitor analogue SB 202474. Bottom row: rAV-met transduced fellow cornea healed in 6 days in the presence of 10 μM of the specific p38 inhibitor SB 202190. (B, top row) rAV-cmet–transduced diabetic cornea healed in 3 days in the presence of 10 μM SB 202474. Bottom row: rAV-met–transduced fellow cornea healed in 7 days in the presence of 10 μM SB 202190. Pictures of live corneas are shown. Analogue-treated corneas healed on average at 3.2 ± 0.4 days, compared with 5.7 ± 0.9 days for inhibitor-treated corneas (P < 0.05). p38 inhibitor thus abrogates c-met–induced acceleration of epithelial wound healing. Dashed line: shows the boundaries of the nonhealed wound region. W, wound zone; E, migrating epithelium.

Article Snippet: The following gene-specific assay kits were used as per ABI: c-met proto-oncogene assay ID Hs00179845_m1 (GenBank RefSeq {"type":"entrez-nucleotide","attrs":{"text":"NM_001127500.1","term_id":"188595715","term_text":"NM_001127500.1"}} NM_001127500.1 , exon boundary 10-11; assay location, 2605; amplicon size, 81 bp) and β 2 -microglobulin assay ID Hs99999907_m1 (GenBank RefSeq {"type":"entrez-nucleotide","attrs":{"text":"NM_004048.2","term_id":"37704380","term_text":"NM_004048.2"}} NM_004048.2 , exon boundary 2-3; assay location, 413; amplicon size, 75 bp) ( www.ncbi.nlm.nih.gov/locuslink/refseq/ RefSeq is provided in the public domain by the National Center for Biotechnology Information, Bethesda, MD).

Techniques: Plasmid Preparation

Journal: STAR Protocols

Article Title: Cloning BRD4 long isoform into overexpression vectors for stable overexpression of BRD4-L in mammalian cells

doi: 10.1016/j.xpro.2022.101785

Figure Lengend Snippet:

Article Snippet: Download the appropriate sequences. a. Download the Reference Sequence for Homo sapiens bromodomain containing 4 (BRD4), transcript variant long, mRNA (GenBank: NM_058243.3) from the NCBI’s website, using the GenBank data base ( BRD4-L RefSeq ). b. Download the sequence for LentiV_Blast (Addgene, cat# 111887) from Addgene’s website ( LentiV_Blast ).

Techniques: Virus, Recombinant, Cloning, Gel Extraction, Plasmid Preparation, Sequencing, Over Expression, Expressing, Software, Imaging

Journal: Immunity

Article Title: The xenobiotic transporter Mdr1 enforces T cell homeostasis in the presence of intestinal bile acids

doi: 10.1016/j.immuni.2017.11.012

Figure Lengend Snippet:

Article Snippet: Rag1 −/− Slc10a2 −/− This paper N/A Oligonucleotides Abcb1a ametrine 5′ CRISPR gRNA: 5′-GCUUCUCAAUGGUCAGUGUGCUGUUUUA GAGCUAGAAAUAGCAAGUUAAAAUAAGG CUAGUCCGUUAUCAACUUGAAAAAGUGG CACCGAGUCGGUGCUUUU-3′ PNA Bio Inc. N/A ametrine Abcb1a 3′ CRISPR gRNA: 5′-GAAAAUACUUAACAUCUUACAUGUUUUA GAGCUAGAAAUAGCAAGUUAAAAUAAGG CUAGUCCGUUAUCAACUUGAAAAAGUGG CACCGAGUCGGUGCUUUU-3′ PNA Bio Inc. N/A Universal 16S rDNA Forward: 5′-ACTCCTACGGGAGGCAGCAGT-3′ Integrated DNA Technologies Ayres et al., 2012 Universal 16S rDNA Reverse: 5′-ATTACCGCGGCTGCTGGC-3′ Integrated DNA Technologies Ayres et al., 2012 Abcb1a ametrine 5′ Genotype Primer: 5′-AGTTTAACGTGTCTGCAGCTGG-3′ Integrated DNA Technologies N/A Abcb1a ametrine 3′ Genotype Primer: 5′-AGCCTGCAGGATCTGTCTG-3′ Integrated DNA Technologies N/A Recombinant DNA Plasmid: LMPd-ametrine Chen et al., 2014 Dr. Matthew Pipkin Plasmid: LMPd-GFP This paper N/A Plasmid: pSTBlue-1 Novagen Cat# 70199 shRNAmir: Cd8a TransOMIC Technologies Cat# TLMSU1400-12525 shRNAmir: Abcb1a TransOMIC Technologies Cat# TLMSU1400-18671 shRNAmir: Abcb1b TransOMIC Technologies Cat# TLMSU1400-18669 pHaMDRwt Pastan et al., 1988 Addgene Plasmid #10957 LMPd.hMDR1-ametrine (containing wild-type human MDR1) (NCBI reference sequence {"type":"entrez-nucleotide","attrs":{"text":"NM_001348945.1","term_id":"1149123046"}} NM_001348945.1 ) This paper N/A LMPd. hMDR1-ametrine (containing transport-deficient human MDR1; Y401A, Y1044A) α This paper Kim et al., 2006 Software and Algorithms Graphpad Prism 7 GraphPad Software http://www.graphpad.com FlowJo (Version 9.9.4) TreeStar, Inc. http://www.flowjo.com GenePattern (Version 3.9.10) Broad Institute https://genepattern.broadinstitute.org nSolver Analysis Software (Version 1.1) Nanostring https://www.nanostring.com Other NanoString nCounter Sundrud_03 chip This paper https://www.nanostring.com NanoString nCounter Sundrud_04 chip This paper https://www.nanostring.com Open in a separate window

Techniques: Blocking Assay, Purification, Recombinant, Staining, Gene Expression, Magnetic Beads, Cell Isolation, SYBR Green Assay, Mutagenesis, Detection Assay, Fluorescence, Generated, CRISPR, Plasmid Preparation, Sequencing, Software